Strain Information | |
---|---|
DGRC Number | 114046 |
Genotype with FlyBase Link | w[*]; P{w[+mW.hs]=GawB}NP7020 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1 |
Genotype | w*; P{w+mW.hs=GawB}NP7020 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1 |
Break points/Insertion Site | 77E1 |
Map Viewer | |
Related Genes | CG13251 knrl |
Original Number | 7020 |
Chromosome | 3 |
Comments | FlyBase Insertion: P{GawB}NP7020 Sb is floating. 21Nov2008. M.T. |
Original Comments | comment1:A, comment2:77D1-D4 |
Balancer | TM6UW23-1 |
Cluster id | 2005 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Lethality | semi lethal |
Embryonic Expression | tracheal. expressed in all tr cells from stg 11. also in epi stripe. |
Larval GFP | strong in terminal branch of tr, perifery of wing disc. |
Larval X-gal | stalks of leg/antenna discs, peripodial memb. of wing disc, tr, oesophagil |
Adult GFP | Joints of appendages. wing hinge, leg (tarsas/tibia, tibia/trochanter etc. not in tarsal joints). Pleural membrane of abdomen. stripe in posterior compartment of targite. not in sternite. antenna. sensory bristles in leg, wing margin. pro |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Taniguchi K, Hozumi S, Maeda R, Ooike M, Sasamura T, Aigaki T, Matsuno K. D-JNK signaling in visceral muscle cells controls the laterality of the Drosophila gut. Dev Biol (2007) 311(1) 251-63 [PubMed ID = 17915206] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np33165_0907 |
Strand | Plus |
Insertion Point | 20539423 |
Chromosome Band | 3L |
Flanking Sequence | gtntttnnnnnctantcttnggggnataanccnntttttngggnactnnggtagccttcg gctatcgacgggaccaccttatgttatttcatcatgCCCCAACCGAAAGACAACCAGGGA GAGAGAGAGCGAGAGTGAGACTTAAAAGAGCGACTTTGACTCAAATTGCCTGTCTGTGTG AGCCGCTGTTTGAGTGATGTTAACTCAAATCCGAGTCGATTCGGCTATTGAGTTGTATTC ACAgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtcc gttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatga agagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgag tcaatcgatacagtcaactgtctttgacctttgttactactctcttccgatgatgatgtc gcacttattctatgctgtctcaatgttagaggcatatcagtctccactgaagccatctta ttctggnnnnnnnnntnnnnannnnatgnnnnncttatnntntgctcnntngntgntgga cgcatntnnntctncactgnngccaatgnntnntnnntnnnnnatntnnntnnnnngntn nnnnnnnnntnnntnnnnnnnnnnnnnnnnnnnnnnnnnntnntnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnntnnnnnnnnttnnnnnnnnnnnnnnnnnnnnnnnnnnnn cntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnntntnnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnntnnnnnnnnnnnnnnnncnna |